CCL4L1 (NM_207007) Human 3' UTR Clone

CAT#: SC204382

3`UTR clone of chemokine (C-C motif) ligand 4-like 2 (CCL4L2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CCL4L1
• Synonyms: AT744.2; CCL4L; LAG-1; LAG1; MIP-1-beta; SCYA4L; SCYA4L1; SCYA4L2
• ACCN: NM_207007
• Insert Size: 299
• Sequence Data:
  Insert Sequence

  >SC204382 3'UTR clone of NM_207007
  The sequence shown below is from the reference sequence of NM_207007. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CGTGTATGACCTGGAACTGAACTGAGCTGCTCAGAGACAGGAAGTCTTCAGGGAAGGTCACCTGAGCCTG
  GATGCTTCTCCATGAGCCGCATCTCCTCCATACTCAGGACTCCTCTCCGCAGTTCCTGTCTCTTCTCTTA
  ATGTAATCTCTTTTATGTGCTGTATTATTGTATTAGGTGTTATTTCCATTATTTATATTAGTTTAGCCAA
  AGGATAAGTGTCCCCTATGGGGATGGTCCACTCTCACTCTTTCTCTGCTGTTGCAAATACATGGATAACA
  CCGTTAATTCCATGTGTTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_207007.2
• Summary: This gene is one of several cytokine genes that are clustered on the q-arm of chromosome 17. Cytokines are a family of secreted proteins that function in inflammatory and immunoregulatory processes. The protein encoded by this family member is similar to the chemokine (C-C motif) ligand 4 product, which inhibits HIV entry by binding to the cellular receptor CCR5. The copy number of this gene varies among individuals, where most individuals have one to five copies. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2014]
• Locus ID: 388372