GAS 6 (GAS6) (NM_001143946) Human 3' UTR Clone

CAT#: SC204409

3`UTR clone of growth arrest-specific 6 (GAS6) transcript variant 3 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GAS6
• Synonyms: AXLLG; AXSF
• ACCN: NM_001143946
• Insert Size: 333 bp
• Sequence Data:
  Insert Sequence

  >SC204409 3'UTR clone of NM_001143946
  The sequence shown below is from the reference sequence of NM_001143946. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACATCACGGCCCACTCCTGCCCCCCCGTGGAGCCCGCCGCAGCCTAGGCCCCCACGGGACGCGGCAGGCT
  TCTCAGTCTCTGTCCGAGACAGCCGGGAGGAGCCTGGGGGCTCCTCACCACGTGGGGCCATGCTGAGAGC
  TGGGCTTTCCTCTGTGACCATCCCGGCCTGTAACATATCTGTAAATAGTGAGATGGACTTGGGGCCTCTG
  ACGCCGCGCACTCAGCCGTGGGCCCGGGCGCGGGGAGGCCGGCGCAGCGCAGAGCGGGCTCGAAGAAAAT
  AATTCTCTATTATTTTTATTACCAAGCGCTTCTTTCTGACTCTAAAATATGGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001143946.1
• Summary: 'This gene encodes a gamma-carboxyglutamic acid (Gla)-containing protein thought to be involved in the stimulation of cell proliferation. This gene is frequently overexpressed in many cancers and has been implicated as an adverse prognostic marker. Elevated protein levels are additionally associated with a variety of disease states, including venous thromboembolic disease, systemic lupus erythematosus, chronic renal failure, and preeclampsia. [provided by RefSeq, Aug 2014]'
• Locus ID: 2621