VAMP8 (NM_003761) Human 3' UTR Clone

CAT#: SC204418

3`UTR clone of vesicle-associated membrane protein 8 (endobrevin) (VAMP8) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: VAMP8
• Synonyms: EDB; VAMP-8
• ACCN: NM_003761
• Insert Size: 335
• Sequence Data:
  Insert Sequence

  >SC204418 3'UTR clone of NM_003761
  The sequence shown below is from the reference sequence of NM_003761. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CATTGTGCTCTTTGCCACTGGTGCCTTCTCTTAAGTAACAGGGAACCTCTCCCACCTGCCCTTCTCTTCA
  GGGACAACCCTCCATAAATGTGTGCCAAGAGGGTCTCCTTTCCTGTCTTCCTCTACAGAGAATGCTGCTC
  GGTCCTCCTACCCCTCTTCCCGAGGCCCTGCTGCCATGTTGTATGCCCCAGAAGGTACCTTGGTCCCCCG
  GAAGGAGAGAAAAAAGAGAGATGGACTGTGGCTGCATTTCTTGGGTCCTTAGAGTGGGCTGGAGAGACCT
  AGAGGGCCCAGCATGTGGCTGGGAAACTGTTGGTGGCCAGTGGGTAATAAAGACC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_003761.3
• Summary: This gene encodes an integral membrane protein that belongs to the synaptobrevin/vesicle-associated membrane protein subfamily of soluble N-ethylmaleimide-sensitive factor attachment protein receptors (SNAREs). The encoded protein is involved in the fusion of synaptic vesicles with the presynaptic membrane. [provided by RefSeq, Jun 2010]
• Locus ID: 8673