SMOX (NM_175841) Human 3' UTR Clone

CAT#: SC204430

3`UTR clone of spermine oxidase (SMOX) transcript variant 3 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SMOX
• Synonyms: C20orf16; PAO; PAO-1; PAO1; PAOH; PAOH1; SMO
• ACCN: NM_175841
• Insert Size: 332
• Sequence Data:
  Insert Sequence

  >SC204430 3'UTR clone of NM_175841
  The sequence shown below is from the reference sequence of NM_175841. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCCTCATTGAGATGTACCGAGACCTCTTCCAGCAGGGGACCTGAGGGCTGTCCTCGCTGCTGAGAAGAGC
  CACTAACTCGTGACCTCCAGCCTGCCCCTTGCTGCCGTGTGCTCCTGCCTTCCTGATCCTCTGTAGAAAG
  GATTTTTATCTTCTGTAGAGCTAGCCGCCCTGACTGCCTTCAGACCTGGCCCTGTAGCTTTTCTTTTTCT
  CCAGGCTGGGCCGTGAGCAGGTGGGCCGTTGAGTTACCTCTGTGCTGGATCCCGTGCCCCCACTTGCCTA
  CCCTCTGTCCTGCCTTGTTATTGTAAGTGCCTTCAATACTTTGCATTTTGGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_175841.1
• Summary: Polyamines are ubiquitous polycationic alkylamines which include spermine, spermidine, putrescine, and agmatine. These molecules participate in a broad range of cellular functions which include cell cycle modulation, scavenging reactive oxygen species, and the control of gene expression. These molecules also play important roles in neurotransmission through their regulation of cell-surface receptor activity, involvement in intracellular signalling pathways, and their putative roles as neurotransmitters. This gene encodes an FAD-containing enzyme that catalyzes the oxidation of spermine to spermadine and secondarily produces hydrogen peroxide. Multiple transcript variants encoding different isoenzymes have been identified for this gene, some of which have failed to demonstrate significant oxidase activity on natural polyamine substrates. The characterized isoenzymes have distinctive biochemical characteristics and substrate specificities, suggesting the existence of additional levels of complexity in polyamine catabolism. [provided by RefSeq, Jul 2012]
• Locus ID: 54498