ASPA (NM_000049) Human 3' UTR Clone

CAT#: SC204442

3`UTR clone of aspartoacylase (Canavan disease) (ASPA) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ASPA
• Synonyms: ACY2; ASP
• ACCN: NM_000049
• Insert Size: 316 bp
• Sequence Data:
  Insert Sequence

  >SC204442 3'UTR clone of NM_000049
  The sequence shown below is from the reference sequence of NM_000049. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AAGTATTCGCTGCTGTTTACATTAGAAATCACTTCCAGCTTACATCTTACACGGTGTCTTACAAATTCTG
  CTAGTCTGTAAGCTCCTTAAGAGTAGGGTTGTGCCTTATTCAACTGCATACATAGCTCCTAGCACAGTGC
  CTTATTCGGTAGGCATCTAAGCAAATTTCTTAAATTAATTAATATATCTTTAAAGATATCATATTTTATG
  TATGTAGCTTATTCAAAGAAGTGTTTCCTATTTCTATATAGTTTATTATACATGATACTTGGGTAGCTCA
  ACATTCTTAATAAACAGCCTTTGTATTCAGAATATA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000049.2
• Summary: 'This gene encodes an enzyme that catalyzes the conversion of N-acetyl_L-aspartic acid (NAA) to aspartate and acetate. NAA is abundant in the brain where hydrolysis by aspartoacylase is thought to help maintain white matter. This protein is an NAA scavenger in other tissues. Mutations in this gene cause Canavan disease. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]'
• Locus ID: 443