DUSP15 (NM_177991) Human 3' UTR Clone

CAT#: SC204458

3`UTR clone of dual specificity phosphatase 15 (DUSP15) transcript variant 2 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "DUSP15"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol DUSP15
Synonyms C20orf57; VHY
ACCN NM_177991
Insert Size 361
Sequence Data
>SC204458 3'UTR clone of NM_177991
The sequence shown below is from the reference sequence of NM_177991. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CGGTGTCTGTCCCGCAAGGGCGGCAAGTGAGGATGCAGTCCAGCCGTGGCTCCCCACTTCCGACTGGCTC
CCTTCGGGGGCTGTCTGCGCCTTCCACGCCCCCCAGGACGGGCCCAGAGGCTGGGGGAGCCCCGCGGCGG
CCTGAACCCTGCCTCCCGCGCCCGCCCTGCTCGTCCGCGTCTGCAGTCAGCGTCCCCAACCTGTGCGTCT
CTGTGTCCGGGCCGGCCTGCTGCAGCCACCTGGTGCCTTAGTCCTTGGGCTGGGGGAGGGGGCCCACCCT
TAAAGGCGGCGGGAGGGGAGGGAGGGAGAGTGGAGGGTTTGACGGGCCTGGAGGGTATTAAAGAGACACA
GAAGAAGCTGC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_177991.1
Summary The protein encoded by this gene has both protein-tyrosine phophatase activity and serine/threonine-specific phosphatase activity, and therefore is known as a dual specificity phosphatase. This protein may function in the differentiation of oligodendrocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Locus ID 128853

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.