DUSP15 (NM_080611) Human 3' UTR Clone

CAT#: SC204460

3`UTR clone of dual specificity phosphatase 15 (DUSP15) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: DUSP15
• Synonyms: C20orf57; VHY
• ACCN: NM_080611
• Insert Size: 361
• Sequence Data:
  Insert Sequence

  >SC204460 3'UTR clone of NM_080611
  The sequence shown below is from the reference sequence of NM_080611. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CGGTGTCTGTCCCGCAAGGGCGGCAAGTGAGGATGCAGTCCAGCCGTGGCTCCCCACTTCCGACTGGCTC
  CCTTCGGGGGCTGTCTGCGCCTTCCACGCCCCCCAGGACGGGCCCAGAGGCTGGGGGAGCCCCGCGGCGG
  CCTGAACCCTGCCTCCCGCGCCCGCCCTGCTCGTCCGCGTCTGCAGTCAGCGTCCCCAACCTGTGCGTCT
  CTGTGTCCGGGCCGGCCTGCTGCAGCCACCTGGTGCCTTAGTCCTTGGGCTGGGGGAGGGGGCCCACCCT
  TAAAGGCGGCGGGAGGGGAGGGAGGGAGAGTGGAGGGTTTGACGGGCCTGGAGGGTATTAAAGAGACACA
  GAAGAAGCTGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_080611.3
• Summary: The protein encoded by this gene has both protein-tyrosine phophatase activity and serine/threonine-specific phosphatase activity, and therefore is known as a dual specificity phosphatase. This protein may function in the differentiation of oligodendrocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
• Locus ID: 128853