DUSP15 (NM_001012644) Human 3' UTR Clone

CAT#: SC204461

3`UTR clone of dual specificity phosphatase 15 (DUSP15) transcript variant 3 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "DUSP15"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol DUSP15
Synonyms C20orf57; VHY
ACCN NM_001012644
Insert Size 361 bp
Sequence Data
>SC204461 3'UTR clone of NM_001012644
The sequence shown below is from the reference sequence of NM_001012644. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CGGTGTCTGTCCCGCAAGGGCGGCAAGTGAGGATGCAGTCCAGCCGTGGCTCCCCACTTCCGACTGGCTC
CCTTCGGGGGCTGTCTGCGCCTTCCACGCCCCCCAGGACGGGCCCAGAGGCTGGGGGAGCCCCGCGGCGG
CCTGAACCCTGCCTCCCGCGCCCGCCCTGCTCGTCCGCGTCTGCAGTCAGCGTCCCCAACCTGTGCGTCT
CTGTGTCCGGGCCGGCCTGCTGCAGCCACCTGGTGCCTTAGTCCTTGGGCTGGGGGAGGGGGCCCACCCT
TAAAGGCGGCGGGAGGGGAGGGAGGGAGAGTGGAGGGTTTGACGGGCCTGGAGGGTATTAAAGAGACACA
GAAGAAGCTGC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001012644.1
Summary The protein encoded by this gene has both protein-tyrosine phophatase activity and serine/threonine-specific phosphatase activity, and therefore is known as a dual specificity phosphatase. This protein may function in the differentiation of oligodendrocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Locus ID 128853

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.