ATP2A1 (NM_173201) Human 3' UTR Clone

CAT#: SC204491

3`UTR clone of ATPase Ca++ transporting cardiac muscle fast twitch 1 (ATP2A1) transcript variant a for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ATP2A1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ATP2A1
Synonyms ATP2A; SERCA1
ACCN NM_173201
Insert Size 321
Sequence Data
>SC204491 3'UTR clone of NM_173201
The sequence shown below is from the reference sequence of NM_173201. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CTCGGAACTACCTAGAGGATCCAGAAGATGAAAGAAGGAAGTGAGCATCCTTTTGCTCTGTCCTCCCCAC
CCCGATAGTGACACATCTTCAGGCAGAGCTGTGGCACAGACCCCCGTCCTGTCCCCCACACCCGTGTCAT
GTGTCTGTTTATAAACATGTCCCCTTCCCTTTCCTTCCCCCTCGGCCACCCGCCTCCCTCTCAACCTTGT
AAATTCCCCTTCCCAACCCCGAGGGGCTTGCAGGGACAAGGCGACCGACTGCGCTGAGCTGCTTATTTAT
TGAAAATAAACGACGGAAAAGTCTGGCCTTGCCTCTGTGCA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_173201.2
Summary This gene encodes one of the SERCA Ca(2+)-ATPases, which are intracellular pumps located in the sarcoplasmic or endoplasmic reticula of muscle cells. This enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol to the sarcoplasmic reticulum lumen, and is involved in muscular excitation and contraction. Mutations in this gene cause some autosomal recessive forms of Brody disease, characterized by increasing impairment of muscular relaxation during exercise. Alternative splicing results in three transcript variants encoding different isoforms. [provided by RefSeq, Oct 2013]
Locus ID 487

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.