Ribophorin II (RPN2) (NM_001135771) Human 3' UTR Clone

CAT#: SC204507

3`UTR clone of ribophorin II (RPN2) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: RPN2
• Synonyms: RIBIIR; RPN-II; RPNII; SWP1
• ACCN: NM_001135771
• Insert Size: 329 bp
• Sequence Data:
  Insert Sequence

  >SC204507 3'UTR clone of NM_001135771
  The sequence shown below is from the reference sequence of NM_001135771. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGGACACTACGAACAGCACATTAGTTCCAGAAGAAAGATGGAAATTCTGAAAACTGAATGTCAAGAAAAG
  GAGTCAAGAACAATTCACAGTATGAGAAGAAAAATGGAAAAAAAAAACTTTATTTAAAAAAGAAAAAAGT
  CCAGATTGTAGTTATACTTTTGCTTGTTTTTCAGTTTCCCCAACACACAGCAGATACCTGGTGAGCTCAG
  ATAGTCTCTTTCTCTGACACTGTGTAAGAAGCTGTGAATATTCCTAACTTACCCAGATGTTGCTTTTGAA
  AAGTTGAAATGTGTAATTGTTTTGGAATAAAGAGGGTAACAATAGGAAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001135771.1
• Summary: 'This gene encodes a type I integral membrane protein found only in the rough endoplasmic reticulum. The encoded protein is part of an N-oligosaccharyl transferase complex that links high mannose oligosaccharides to asparagine residues found in the Asn-X-Ser/Thr consensus motif of nascent polypeptide chains. This protein is similar in sequence to the yeast oligosaccharyl transferase subunit SWP1. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]'
• Locus ID: 6185