TOR1AIP2 (NM_022347) Human 3' UTR Clone

CAT#: SC204511

3`UTR clone of torsin A interacting protein 2 (TOR1AIP2) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TOR1AIP2
• Synonyms: IFRG15; LULL1; NET9
• ACCN: NM_022347
• Insert Size: 356
• Sequence Data:
  Insert Sequence

  >SC204511 3'UTR clone of NM_022347
  The sequence shown below is from the reference sequence of NM_022347. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAGAACAGATAAAACCTTAAACAAAAAACTGGGCCAAAACAAATAGCTTCTATAATAGTCAAAATTGTCA
  AGTCTAGAGGCTTTTGTGTAGGTAGCCCAAGGAAGATGGAAAAATAATTCATTTCTAAGTCTGACCCAGA
  TTGTCACTACTTTGGGAACTGCTTAAATTGTTGGATCTGCTTCCGTGGCCTATACATATTTTATTCACAT
  GAATTTAGTTAGTATTCCAGCCAGCCTGTTCATCTAGACTGAGGCTAATCTGTTCATCTAGACTGAGGCT
  AATCCGTATTTCCTATAAACTGTTTTGGAACTAACTTACCACTCCTAAAAAAATTTCTGCAACCTAATGA
  GTGTCA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_022347.2
• Summary: One of the two protein isoforms encoded by this gene is a type II integral membrane protein found in the endoplasmic reticulum (ER). The encoded protein is a cofactor for the ATPase TorsinA, regulating the amount of TorsinA present in the ER compared to that found in the nuclear envelope. Defects in this protein are a cause of early onset primary dystonia, a neuromuscular disease. The other isoform encoded by this gene is an interferon alpha responsive protein whose cellular role has yet to be determined. [provided by RefSeq, Mar 2017]
• Locus ID: 163590