Neurofascin (NFASC) (NM_001005389) Human 3' UTR Clone

CAT#: SC204514

3`UTR clone of neurofascin homolog (chicken) (NFASC) transcript variant 5 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NFASC
• Synonyms: NEDCPMD; NF; NRCAML
• ACCN: NM_001005389
• Insert Size: 335
• Sequence Data:
  Insert Sequence

  >SC204514 3'UTR clone of NM_001005389
  The sequence shown below is from the reference sequence of NM_001005389. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CACCGTGCTAGGTAACTGCCCATGCTCACCCTGGCACTGACCAGCCCCACCCCCTCCCCAGCAGCCAGAG
  AAGCAGTGGCCCGGGGCAGTTCCGAGGGCAGTGCCTGCAGTCAAGTGGCCGGGTCAGGCGTGGTGATCTC
  TTCTTGCCTCGTGATGTCAGGGTTAGGGAGCTGCCAGTTTCAGAACAAGCTGTGCTGGACAGGTTACCTC
  CTGAGTGGAGTCATTAACTTCCCCACGTCTCAACTGAAAGGGGCCTGAGTGATATAGAGAAAGTGGAGAG
  GGGTTTCTCGTTGTGATCATTTTACCTTTCTTACAGCTAACTCCACCACTAAGTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001005389.1
• Summary: This gene encodes an L1 family immunoglobulin cell adhesion molecule with multiple IGcam and fibronectin domains. The protein functions in neurite outgrowth, neurite fasciculation, and organization of the axon initial segment (AIS) and nodes of Ranvier on axons during early development. Both the AIS and nodes of Ranvier contain high densities of voltage-gated Na+ (Nav) channels which are clustered by interactions with cytoskeletal and scaffolding proteins including this protein, gliomedin, ankyrin 3 (ankyrin-G), and betaIV spectrin. This protein links the AIS extracellular matrix to the intracellular cytoskeleton. This gene undergoes extensive alternative splicing, and the full-length nature of some variants has not been determined. [provided by RefSeq, May 2009]
• Locus ID: 23114