HYAL2 (NM_033158) Human 3' UTR Clone

CAT#: SC204531

3`UTR clone of hyaluronoglucosaminidase 2 (HYAL2) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HYAL2
• Synonyms: LUCA2
• ACCN: NM_033158
• Insert Size: 352
• Sequence Data:
  Insert Sequence

  >SC204531 3'UTR clone of NM_033158
  The sequence shown below is from the reference sequence of NM_033158. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTTTACCTGGACCTTGTAGGGGTCTCCTGCCTAGCTGCCTAGCAAGCTGGCCTCTACCACAAGGGCTCTC
  TTAGGCATGTAGGACCCTGCAGGGGGTGGACAAACTGGAGTCTGGAGTGGGCAGAGCCCCCAGGAAGCCC
  AGGAGGGCATCCATACCAGCTCGCACCCCCCTGTTCTAAGGGGGAGGGGAAGTCCCTGGGAGGCCCCTTC
  TCTCCCTGCCAGAGGGGAAGGAGGGTACAGCTGGGCTGGGGAGGACCTGACCCTACTCCCTTGCCCTAGA
  TAGTTTATTATTATTATTATTTTGGGGTCTCTTTTGTAAATTAAACATAAAACAATTGCTTCTCTGCTTG
  GA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_033158.4
• Summary: This gene encodes a weak acid-active hyaluronidase. The encoded protein is similar in structure to other more active hyaluronidases. Hyaluronidases degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. Hyaluronan and fragments of hyaluronan are thought to be involved in cell proliferation, migration and differentiation. Although it was previously thought to be a lysosomal hyaluronidase that is active at a pH below 4, the encoded protein is likely a GPI-anchored cell surface protein. This hyaluronidase serves as a receptor for the oncogenic virus Jaagsiekte sheep retrovirus. The gene is one of several related genes in a region of chromosome 3p21.3 associated with tumor suppression. This gene encodes two alternatively spliced transcript variants which differ only in the 5' UTR. [provided by RefSeq, Mar 2010]
• Locus ID: 8692