BRMS1 (NM_001024957) Human 3' UTR Clone

CAT#: SC204534

3`UTR clone of breast cancer metastasis suppressor 1 (BRMS1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: BRMS1
• ACCN: NM_001024957
• Insert Size: 327 bp
• Sequence Data:
  Insert Sequence

  >SC204534 3'UTR clone of NM_001024957
  The sequence shown below is from the reference sequence of NM_001024957. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGTGGCCGTGGAGCTGACCTGACCAGGCAAGGCTGCTGTCTCCATCCCTGAGCCGCCTGCCACCTCCCAC
  TCCTGAAGATCCATCTCTTGGGGCTCCCCTGACAGAGAAGACAGCCGAAGTCAAAGCCACATCCTCTTGC
  TGATGTTGGATGCAGGCTGTCCGGCCTCAGGGCCAGGGAGCCAGTTTCCACTGTGCGGGAACTCTGAGTC
  AGACGTGATTATCTGGGGGTCTGTCCACCCTGGCTGGATCTGGAGGCAAGATGCCAGGCCCCCCAGGTGT
  TCTCAGGGCAGTTCTTGGTGTCTGCTTCTCAGATTCCAAGGACTGGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001024957.1
• Summary: This gene reduces the metastatic potential, but not the tumorogenicity, of human breast cancer and melanoma cell lines. The protein encoded by this gene localizes primarily to the nucleus and is a component of the mSin3a family of histone deacetylase complexes (HDAC). The protein contains two coiled-coil motifs and several imperfect leucine zipper motifs. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
• Locus ID: 25855