NUDT9 (NM_198038) Human 3' UTR Clone

CAT#: SC204537

3`UTR clone of nudix (nucleoside diphosphate linked moiety X)-type motif 9 (NUDT9) transcript variant 3 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "NUDT9"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol NUDT9
Synonyms NUDT10
ACCN NM_198038
Insert Size 320
Sequence Data
>SC204537 3'UTR clone of NM_198038
The sequence shown below is from the reference sequence of NM_198038. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AAGCTGACTGCCATGCGTTGTAGCTGATGGTCTCCGTGTAAGCCAAAGGCCCACAGAGGAGCATATACTG
AAAAGAAGGCAGTATCACAGAATTTATACTATAAAAAGGGCAGGGTAGGCCACTTGGCCTATTTACTTTC
AAAACAATTTGCATTTAGAGTGTTTCGCATCAGAATAACATGAGTAAGATGAACTGGAACACAAAATTTT
CAGCTCTTTGGTCAAAAGGAATATAAGTAATCATATTTTGTATGTATTCGATTTAAGCATGGCTTAAATT
AAATTTAAACAACTAATGCTCTTTGAAGAATCATAATCAG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_198038.1
Summary The protein encoded by this gene belongs to the Nudix hydrolase family. Nudix boxes are found in a family of diverse enzymes that catalyze the hydrolysis of nucleoside diphosphate derivatives. This enzyme is an ADP-ribose pyrophosphatase that catalyzes the hydrolysis of ADP-ribose to AMP and ribose-5-P. It requires divalent metal ions and an intact Nudix motif for enzymatic activity. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Locus ID 53343

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.