KCNH3 (NM_012284) Human 3' UTR Clone

CAT#: SC204549

3`UTR clone of potassium voltage-gated channel subfamily H (eag-related) member 3 (KCNH3) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: KCNH3
• Synonyms: BEC1; ELK2; Kv12.2
• ACCN: NM_012284
• Insert Size: 346
• Sequence Data:
  Insert Sequence

  >SC204549 3'UTR clone of NM_012284
  The sequence shown below is from the reference sequence of NM_012284. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGTGGACCCAGGAAGAAGGCACAGGGGTCTGAGTACCAGCCCTAGAACTCAGCGTTGCCAGGTGTGCTGC
  CATCTGCTGTTCGGCCCAACCTCAGAGTGAAGGCAGGGTGGCAGCCTCCCCACGGACTCCATGCGGCCCG
  CTGGCTCAGGGCAGGGAGCCTGGAAGCAAAGGAGGACCTGGCTCCTGACTCTCAGAGAGGATAGGCTGGA
  TCCCTGGGGCAGGCCTCTCCTCGGCCTGCTCCTCTGACCTCCCGGTCTCCCTCTGCAGGCTGGGGGCAGA
  GGCCTGAGGACAAGGAAGAGCTTTGCCATCCCCTGCATGTGCCCCTGCCTCTACCTGTCCCCAAAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_012284.1
• Summary: The protein encoded by this gene is a voltage-gated potassium channel alpha subunit predominantly expressed in the forebrain. Studies in mice have found that cognitive function increases when this gene is knocked out. In humans, the encoded protein has been shown to be capable of binding glycoprotein 120 of the human immunodeficiency virus type 1 (HIV-1) envelope. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
• Locus ID: 23416