Apolipoprotein CII (APOC2) (NM_000483) Human 3' UTR Clone

CAT#: SC204594

3`UTR clone of apolipoprotein C-II (APOC2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: APOC2
• Synonyms: APO-CII; APOC-II
• ACCN: NM_000483
• Insert Size: 314 bp
• Sequence Data:
  Insert Sequence

  >SC204594 3'UTR clone of NM_000483
  The sequence shown below is from the reference sequence of NM_000483. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTTTCTGTGCTGAAGGGAGAGGAGTAACAGCCAGACCCCCCATCAGTGGACAAGGGGAGAGTCCCCTACT
  CCCCTGATCCCCCAGGTTCAGACTGAGCTCCCCCTTCCCAGTAGCTCTTGCATCCTCCTCCCAACTCTAG
  CCTGAATTCTTTTCAATAAAAAATACAATTCAAGTTGCTTCTCATGGATGGCACTGCTTTTCTGAGGACT
  CAAGGGCCAAGATGGAGGGGCTGACTCAGTCCAGCCAACATTTAATGAGCACCTACTTTATGTATGGAGC
  TCTAACCCATGGGTCCATGGGAATAAAGCAGTGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000483.3
• Summary: 'This gene encodes a lipid-binding protein belonging to the apolipoprotein gene family. The protein is secreted in plasma where it is a component of very low density lipoprotein. This protein activates the enzyme lipoprotein lipase, which hydrolyzes triglycerides and thus provides free fatty acids for cells. Mutations in this gene cause hyperlipoproteinemia type IB, characterized by hypertriglyceridemia, xanthomas, and increased risk of pancreatitis and early atherosclerosis. This gene is present in a cluster with other related apolipoprotein genes on chromosome 19. Naturally occurring read-through transcription exists between this gene and the neighboring upstream apolipoprotein C-IV (APOC4) gene. [provided by RefSeq, Mar 2011]'
• Locus ID: 344