HSD11B1L (NM_198704) Human 3' UTR Clone

CAT#: SC204600

3`UTR clone of hydroxysteroid (11-beta) dehydrogenase 1-like (HSD11B1L) transcript variant f for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "HSD11B1L"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol HSD11B1L
Synonyms 11-beta-HSD3; 11-DH3; HSD1L; HSD3; SCDR10; SCDR10B; SDR26C2
ACCN NM_198704
Insert Size 322
Sequence Data
>SC204600 3'UTR clone of NM_198704
The sequence shown below is from the reference sequence of NM_198704. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CTCACCTGTTTGGCCATGATTGATGACGTGACTGCTTCCATTTTGCAGATGAGGAAACTAAGGCTCAGAG
AGGCCACGCCACCCTTGAGCCACCCATGGACCCCTCTCCATCTCCTGCCTGCGCCTTTAAGTCCCTGATT
TATTCTTTCCATTCATTCCATCTGGGAGGAACCCCCCCAACTCCTGCCAGCTTCCCCTAGCTGGGGTCTC
TGGTACTCTTCACACCTGCAGGGGCGTCTACACTGTTCGTCTACCTGGTGGCAGGGTCTGAGCGGGAGGA
GGAGGGAAAGAGTGTGTTCTGAGCTGGACCCAGCCTCTTGTT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_198704.1
Summary This gene is a member of the hydroxysteroid dehydrogenase family. The encoded protein is similar to an enzyme that catalyzes the interconversion of inactive to active glucocorticoids (e.g. cortisone). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jun 2012]
Locus ID 374875

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.