CDC5L (NM_001253) Human 3' UTR Clone

CAT#: SC204603

3`UTR clone of CDC5 cell division cycle 5-like (S. pombe) (CDC5L) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CDC5L
• Synonyms: CDC5; CDC5-LIKE; CEF1; dJ319D22.1; PCDC5RP
• ACCN: NM_001253
• Insert Size: 348 bp
• Sequence Data:
  Insert Sequence

  >SC204603 3'UTR clone of NM_001253
  The sequence shown below is from the reference sequence of NM_001253. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCTGATTTGCTGCTGGAGAAAGAGACTTTAAAGTCAAAATTCTGAAGTACAGTTTATATTCTGTCACAGG
  ATTAATTAATTGCCGGTTTTCATACTCTAGAAGGCTGAAACTGATGTTTATCTTCATTGACAAATTTACC
  CACCATCTGTGGTTTTTCAGTTGTTTATTTTAAATGATATCGATCTTACACATTCTGTGTATAAAGACCT
  TAACTCCACAGGACGGACATTTTAGAGTTTAAATTATTAAGGCTATCATTCTTTTAGTAATGTCATATTT
  GCAAACTTTTTTAGTTTTGGCCTTTAATTTAAAAAGCCTAATTTTAAAGTGCTGCCTTTGAGTAACTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001253.2
• Summary: 'The protein encoded by this gene shares a significant similarity with Schizosaccharomyces pombe cdc5 gene product, which is a cell cycle regulator important for G2/M transition. This protein has been demonstrated to act as a positive regulator of cell cycle G2/M progression. It was also found to be an essential component of a non-snRNA spliceosome, which contains at least five additional protein factors and is required for the second catalytic step of pre-mRNA splicing. [provided by RefSeq, Jul 2008]'
• Locus ID: 988