ORC3L (ORC3) (NM_181837) Human 3' UTR Clone

CAT#: SC204614

3`UTR clone of origin recognition complex subunit 3-like (yeast) (ORC3L) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ORC3"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ORC3
Synonyms LAT; LATHEO; ORC3L
ACCN NM_181837
Insert Size 370
Sequence Data
>SC204614 3'UTR clone of NM_181837
The sequence shown below is from the reference sequence of NM_181837. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CAGAAGACTGACCATGTGGCAAGACTAACATGGGGAGGCTGCTAGAAAGCAAATAAGCAAAGCCAGAACT
ATCACATTTAGCTTAAGAGAAAAAGGTGACCAGTCATATTTACATATATTAGAGGAGCCTGTTTTGTTGA
GAAGATAAATGTGTAACCCCCATTGATGTTTAACCAGAAAAGTACATTGCTAACCCCAAACAGGCATGTA
TCAAAACACCTGTGGAGTACTTTAGACTCCAACAAATAATAATGTAACTAAAACTGCTCACACATTTTAC
TGTACTTTCCAAAGTCATTACTAAATTGTGAGTAAATCATTCTTGAACTTAGAGTATGTAAATGTAATAA
ATTCCGTTATCCAGGAGTAT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_181837.1
Summary The origin recognition complex (ORC) is a highly conserved six subunits protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. The protein encoded by this gene is a subunit of the ORC complex. Studies of a similar gene in Drosophila suggested a possible role of this protein in neuronal proliferation and olfactory memory. Alternatively spliced transcript variants encoding distinct isoforms have been reported for this gene. [provided by RefSeq, Jul 2008]
Locus ID 23595

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.