Carbonic Anhydrase I (CA1) (NM_001128830) Human 3' UTR Clone

CAT#: SC204643

3`UTR clone of carbonic anhydrase I (CA1) transcript variant 3 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CA1
Synonyms CA-I; CAB; Car1; HEL-S-11
ACCN NM_001128830
Insert Size 339 bp
Sequence Data
>SC204643 3'UTR clone of NM_001128830
The sequence shown below is from the reference sequence of NM_001128830. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GCAGAACAGTGAGAGCTTCATTTTGATGATTCTGAGAAGAAACTTGTCCTTCCTCAAGAACACAGCCCTG
CTTCTGACATAATCCAGTAAAATAATAATTTTTAAGAAATAAATTTATTTCAATATTAGCAAGACAGCAT
GCCTTCAAATCAATCTGTAAAACTAAGAAACTTAAATTTTAGTTCTTACTGCTTAATTCAAATAATAATT
AGTAAGCTAGCAAATAGTAATCTGTAAGCATAAGCTTATGCTTAAATTCAAGTTTAGTTTGAGGAATTCT
TTAAAATTACAACTAAGTGATTTGTATGTCTATTTTTTTCAGTTTATTTGAACCAATAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001128830.2
Summary 'Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. This CA1 gene is closely linked to the CA2 and CA3 genes on chromosome 8. It encodes a cytosolic protein that is found at the highest level in erythrocytes. Allelic variants of this gene have been described in some populations. Alternative splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Nov 2016]'
Locus ID 759

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.