SHP1 (PTPN6) (NM_080549) Human 3' UTR Clone

CAT#: SC204662

3`UTR clone of protein tyrosine phosphatase non-receptor type 6 (PTPN6) transcript variant 3 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PTPN6
• Synonyms: HCP; HCPH; HPTP1C; PTP-1C; SH-PTP1; SHP-1; SHP-1L; SHP1
• ACCN: NM_080549
• Insert Size: 280 bp
• Sequence Data:
  Insert Sequence

  >SC204662 3'UTR clone of NM_080549
  The sequence shown below is from the reference sequence of NM_080549. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCACACTAAGAACAAGAGGGAGGAGAAAGTGAAGAAGCAGCGGTCAGCAGACAAGGAGAAGAGCAAGGGT
  TCCCTCAAGAGGAAGTGAGCGGTGCTGTCCTCAGGTGGCCATGCCTCAGCCCTGACCCTGTGGAAGCATT
  TCGCGATGGACAGACTCACAACCTGAACCTAGGAGTGCCCCATTCTTTTGTAATTTAAATGGCTGCATCC
  CCCCCACCTCTCCCTGACCCTGTATATAGCCCAGCCAGGCCCCAGGCAGGGCCAACCCTTCTCCTCTTGT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_080549.3
• Summary: 'The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. N-terminal part of this PTP contains two tandem Src homolog (SH2) domains, which act as protein phospho-tyrosine binding domains, and mediate the interaction of this PTP with its substrates. This PTP is expressed primarily in hematopoietic cells, and functions as an important regulator of multiple signaling pathways in hematopoietic cells. This PTP has been shown to interact with, and dephosphorylate a wide spectrum of phospho-proteins involved in hematopoietic cell signaling. Multiple alternatively spliced variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jul 2008]'
• Locus ID: 5777