ORC3L (ORC3) (NM_012381) Human 3' UTR Clone

CAT#: SC204672

3`UTR clone of origin recognition complex subunit 3-like (yeast) (ORC3L) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ORC3
• Synonyms: LAT; LATHEO; ORC3L
• ACCN: NM_012381
• Insert Size: 370
• Sequence Data:
  Insert Sequence

  >SC204672 3'UTR clone of NM_012381
  The sequence shown below is from the reference sequence of NM_012381. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAGAAGACTGACCATGTGGCAAGACTAACATGGGGAGGCTGCTAGAAAGCAAATAAGCAAAGCCAGAACT
  ATCACATTTAGCTTAAGAGAAAAAGGTGACCAGTCATATTTACATATATTAGAGGAGCCTGTTTTGTTGA
  GAAGATAAATGTGTAACCCCCATTGATGTTTAACCAGAAAAGTACATTGCTAACCCCAAACAGGCATGTA
  TCAAAACACCTGTGGAGTACTTTAGACTCCAACAAATAATAATGTAACTAAAACTGCTCACACATTTTAC
  TGTACTTTCCAAAGTCATTACTAAATTGTGAGTAAATCATTCTTGAACTTAGAGTATGTAAATGTAATAA
  ATTCCGTTATCCAGGAGTAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_012381.2
• Summary: The origin recognition complex (ORC) is a highly conserved six subunits protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. The protein encoded by this gene is a subunit of the ORC complex. Studies of a similar gene in Drosophila suggested a possible role of this protein in neuronal proliferation and olfactory memory. Alternatively spliced transcript variants encoding distinct isoforms have been reported for this gene. [provided by RefSeq, Jul 2008]
• Locus ID: 23595