SH2D2A (NM_001161441) Human 3' UTR Clone

CAT#: SC204708

3`UTR clone of SH2 domain protein 2A (SH2D2A) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SH2D2A
• Synonyms: F2771; SCAP; TSAD; VRAP
• ACCN: NM_001161441
• Insert Size: 370
• Sequence Data:
  Insert Sequence

  >SC204708 3'UTR clone of NM_001161441
  The sequence shown below is from the reference sequence of NM_001161441. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGAGGACAGGCATGGCTTCCCCTTGGGCCTCCTCAGTAGGCGGTCTGGCCTGACCCCCAACAAAGAAGCC
  TGGAGGTCAGAGAAGCAAATGCGGAGCCTGCTCCCTCCTAAGAAGATCCCAAGAATCCAATGGCTCAGTC
  CTTGGTGATCTAAGACAGCAAAGAAGTGTGCAAGGAGGGCCCTGTTAGCTCCCACTGTCCTGGTTTCTCC
  TCCTGGAGTCTAATTTCCTTGGCCCTCTGAGCCTTTTGAGTCTGGGCCCTGGTCCAATGCTGCTGTTGTC
  TGAGGAATGGTTTGGTGAGAACAGATGTTAGAACTTGTTTGTTGATTCTTGTCTGGCTAATAAATCATCA
  CCAACTGCCTTCTCCTACAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001161441.1
• Summary: This gene encodes an adaptor protein thought to function in T-cell signal transduction. A related protein in mouse is responsible for the activation of lymphocyte-specific protein-tyrosine kinase and functions in downstream signaling. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
• Locus ID: 9047