NDUFB6 (NM_182739) Human 3' UTR Clone

CAT#: SC204710

3`UTR clone of NADH dehydrogenase (ubiquinone) 1 beta subcomplex6 17kDa (NDUFB6) nuclear gene encoding mitochondrial protein transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "NDUFB6"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol NDUFB6
Synonyms B17; CI
ACCN NM_182739
Insert Size 358 bp
Sequence Data
>SC204710 3'UTR clone of NM_182739
The sequence shown below is from the reference sequence of NM_182739. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CACCAATGAAAGAATTTCCTGATCAACATCATTAAAGATTATGTAAAAAGTTAAAAGGCTTATGAGCCTA
AGTTTGTTCCTATATTACCATATTTACTGAATTTTCTGGAAAAGTAACTTTAATAAAGTTTAATCTCAGA
AATTGTCATATCTGTTTTCAAGCATTGTACAATTTGAGACTGAGTAATTTAACAATAAGTAAAAAGTGGA
CATGCTAAACAAATATGAGAGACTACCTACTTTTTCTGGTCATTCTTGACTTGGAAAACGGTATGGAAAA
GTATTTAGTTACATGTTTGTTTGTTTTTTTCTTACACAGTACTTACACTAATTTGGTATCAGGGTATGCA
ACAGTGAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_182739.1
Summary 'The protein encoded by this gene is a subunit of the multisubunit NADH:ubiquinone oxidoreductase (complex I). Mammalian complex I is composed of 45 different subunits. It locates at the mitochondrial inner membrane. This protein has NADH dehydrogenase activity and oxidoreductase activity. It transfers electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. Alternative splicing occurs at this locus and three transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Jan 2011]'
Locus ID 4712

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.