Eph receptor A1 (EPHA1) (NM_005232) Human 3' UTR Clone

CAT#: SC204717

3`UTR clone of EPH receptor A1 (EPHA1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: EPHA1
• Synonyms: EPH; EPHT; EPHT1
• ACCN: NM_005232
• Insert Size: 378 bp
• Sequence Data:
  Insert Sequence

  >SC204717 3'UTR clone of NM_005232
  The sequence shown below is from the reference sequence of NM_005232. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAGAAGCGCATTCTTTGCAGTATTCAGGGATTCAAGGACTGATCCCTCCTCTCACCCCATGCCCAATCAG
  GGTGCAAGGAGCAAGGACGGGGCCAAGGTCGCTCATGGTCACTCCCTGCGCCCCTTCCCACAACCTGCCA
  GACTAGGCTATCGGTGCTGCTTCTGCCCACTTTCAGGAGAACCCTGCTCTGCACCCCAGAAAACCTCTTT
  GTTTTAAAAGGGAGGTGGGGGTAGAAGTAAAAGGATGATCATGGGAGGGAGCTGAGGGGTTAATATATAT
  ACATACATACACATATATATATTTTTGTAAATAAACAGGAACTGATTTTCTGCCTCCATCCCACCCATGA
  GGGCTGCAGGCACTACAAAAGAGCTGAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_005232.4
• Summary: 'This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. This gene is expressed in some human cancer cell lines and has been implicated in carcinogenesis. [provided by RefSeq, Jul 2008]'
• Locus ID: 2041