UGP2 (NM_001001521) Human 3' UTR Clone

CAT#: SC204735

3`UTR clone of UDP-glucose pyrophosphorylase 2 (UGP2) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: UGP2
• Synonyms: EIEE83; pHC379; SVUGP2; UDPG; UDPGP; UDPGP2; UGP1; UGPP1; UGPP2
• ACCN: NM_001001521
• Insert Size: 341 bp
• Sequence Data:
  Insert Sequence

  >SC204735 3'UTR clone of NM_001001521
  The sequence shown below is from the reference sequence of NM_001001521. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGTGTCTGGAAACCTTCGCATCTTGGACCACTGAAATGAAAAATACTGTGGACACTTAAATAATGGGCTA
  GTTTCTTACAATGAAATGTTCTCTAGGATTCTAAAATAGGCAGGTACTTTACTATGTTACTGTACCCTGC
  AGTGTTGATTTTTAAAATAGAGTTTTCTGCAGTATGCTTTTAGTCTAAGAAAAGCACAGATGGAGCAATA
  CTTTCCTTCTTTGAAGAGAATCCCAAAAGTTAGTTCATCTTAAAGTGCAATATTGTTTAATCTTAAAACT
  GGGCAACTTTGGAAGAACTTTTAACAGAAGCCTCAATGATGATCACTTTGAATTGCTTGTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001001521.1
• Summary: 'The enzyme encoded by this gene is an important intermediary in mammalian carbohydrate interconversions. It transfers a glucose moiety from glucose-1-phosphate to MgUTP and forms UDP-glucose and MgPPi. In liver and muscle tissue, UDP-glucose is a direct precursor of glycogen; in lactating mammary gland it is converted to UDP-galactose which is then converted to lactose. The eukaryotic enzyme has no significant sequence similarity to the prokaryotic enzyme. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]'
• Locus ID: 7360