TXNRD2 (NM_006440) Human 3' UTR Clone

CAT#: SC204777

3`UTR clone of thioredoxin reductase 2 (TXNRD2) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TXNRD2
• Synonyms: GCCD5; SELZ; TR; TR-BETA; TR3; TRXR2
• ACCN: NM_006440
• Insert Size: 344
• Sequence Data:
  Insert Sequence

  >SC204777 3'UTR clone of NM_006440
  The sequence shown below is from the reference sequence of NM_006440. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACAGGCTGCTGAGGGTAAGCGCCATCCCTGCAGGCCAGGGCACACGGTGCGCCCGCCGCCAGCTCCTCGG
  AGGCCAGACCCAGGATGGCTGCAGGCCAGGTTTGGGGGGCCTCAACCCTCTCCTGGAGCGCCTGTGAGAT
  GGTCAGCGTGGAGCGCAAGTGCTGGACAGGTGGCCCGTGTGCCCCACAGGGATGGCTCAGGGGACTGTCC
  ACCTCACCCCTGCACCTCTCAGCCTCTGCCGCCGGGCACCCCCCCCCAGGCTCCTGGTGCCAGATGATGA
  CGACCTGGGTGGAAACCTACCCTGTGGGCACCCATGTCCGAGCCCCCTGGCATTTCTGCAATGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_006440.3
• Summary: The protein encoded by this gene belongs to the pyridine nucleotide-disulfide oxidoreductase family, and is a member of the thioredoxin (Trx) system. Three thioredoxin reductase (TrxR) isozymes are found in mammals. TrxRs are selenocysteine-containing flavoenzymes, which reduce thioredoxins, as well as other substrates, and play a key role in redox homoeostasis. This gene encodes a mitochondrial form important for scavenging reactive oxygen species in mitochondria. It functions as a homodimer containing FAD, and selenocysteine (Sec) at the active site. Sec is encoded by UGA codon that normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, the Sec insertion sequence (SECIS) element, which is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. Alternatively spliced transcript variants encoding different isoforms, including a few localized in the cytosol and some lacking the C-terminal Sec residue, have been found for this gene. [provided by RefSeq, Jun 2017]
• Locus ID: 10587