TCPTP (PTPN2) (NM_080422) Human 3' UTR Clone

CAT#: SC204780

3`UTR clone of protein tyrosine phosphatase non-receptor type 2 (PTPN2) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PTPN2
• Synonyms: PTN2; PTPT; TC-PTP; TCELLPTP; TCPTP
• ACCN: NM_080422
• Insert Size: 351 bp
• Sequence Data:
  Insert Sequence

  >SC204780 3'UTR clone of NM_080422
  The sequence shown below is from the reference sequence of NM_080422. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCCAAGATTGACAGACACCTAATATTCATGACTTGAGAATATTCTGCAGCTATAAATTTTGAACCATTGA
  TGTGCAAAGCAAGACCTGAAGCCCACTCCGGAAACTAAAGTGAGGCTCGCTAACCCTCTAGATTGCCTCA
  CAGTTGTTTGTTTACAAAGTAAACTTTACATCCAGGGGATGAAGAGCACCCACCAGCAGAAGACTTTGCA
  GAACCTTTAATTGGATGTGTTAAGTGTTTTTAATGAGTGTATGAAATGTAGAAAGATGTACAAGAAATAA
  ATTAGGAGAGATTACTTTGTATTGTACTGCCATTCCTACTGTATTTTTATACTTTTTGGCAGCATTAAAT
  A
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_080422.1
• Summary: 'The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. Members of the PTP family share a highly conserved catalytic motif, which is essential for the catalytic activity. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. Epidermal growth factor receptor and the adaptor protein Shc were reported to be substrates of this PTP, which suggested the roles in growth factor mediated cell signaling. Multiple alternatively spliced transcript variants encoding different isoforms have been found. Two highly related but distinctly processed pseudogenes that localize to chromosomes 1 and 13, respectively, have been reported. [provided by RefSeq, May 2011]'
• Locus ID: 5771