Cytochrome P450 2C8 (CYP2C8) (NM_000770) Human 3' UTR Clone

CAT#: SC204785

3`UTR clone of cytochrome P450 family 2 subfamily C polypeptide 8 (CYP2C8) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CYP2C8
• Synonyms: CPC8; CYP2C8DM; CYPIIC8; MP-12/MP-20
• ACCN: NM_000770
• Insert Size: 377 bp
• Sequence Data:
  Insert Sequence

  >SC204785 3'UTR clone of NM_000770
  The sequence shown below is from the reference sequence of NM_000770. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTTTCTCTGCCACCCTCATACCAGATCTGCTTCATCCCTGTCTGAAGAATGCTAGCCCATCTGGCTGCCG
  ATCTGCTATCACCTGCAACTCTTTTTTTATCAAGGACATTCCCACTATTATGTCTTCTCTGACCTCTCAT
  CAAATCTTCCCATTCACTCAATATCCCATAAGCATCCAAACTCCATTAAGGAGAGTTGTTCAGGTCACTG
  CACAAATATATCTGCAATTATTCATACTCTGTAACACTTGTATTAATTGCTGCATATGCTAATACTTTTC
  TAATGCTGACTTTTTAATATGTTATCACTGTAAAACACAGAAAAGTGATTAATGAATGATAATTTAGATC
  CATTTCTTTTGTGAATGTGCTAAATAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000770.3
• Summary: 'This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and its expression is induced by phenobarbital. The enzyme is known to metabolize many xenobiotics, including the anticonvulsive drug mephenytoin, benzo(a)pyrene, 7-ethyoxycoumarin, and the anti-cancer drug taxol. This gene is located within a cluster of cytochrome P450 genes on chromosome 10q24. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]'
• Locus ID: 1558