IL2 Receptor gamma (IL2RG) (NM_000206) Human 3' UTR Clone

CAT#: SC204808

3`UTR clone of interleukin 2 receptor gamma (severe combined immunodeficiency) (IL2RG) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: IL2RG
• Synonyms: CD132; CIDX; IL-2RG; IMD4; P64; SCIDX; SCIDX1
• ACCN: NM_000206
• Insert Size: 320 bp
• Sequence Data:
  Insert Sequence

  >SC204808 3'UTR clone of NM_000206
  The sequence shown below is from the reference sequence of NM_000206. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CACCCTAAAGCCTGAAACCTGAACCCCAATCCTCTGACAGAAGAACCCCAGGGTCCTGTAGCCCTAAGTG
  GTACTAACTTTCCTTCATTCAACCCACCTGCGTCTCATACTCACCTCACCCCACTGTGGCTGATTTGGAA
  TTTTGTGCCCCCATGTAAGCACCCCTTCATTTGGCATTCCCCACTTGAGAATTACCCTTTTGCCCCGAAC
  ATGTTTTTCTTCTCCCTCAGTCTGGCCCTTCCTTTTCGCAGGATTCTTCCTCCCTCCCTCTTTCCCTCCC
  TTCCTCTTTCCATCTACCCTCCGATTGTTCCTGAACCGAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000206.2
• Summary: 'The protein encoded by this gene is an important signaling component of many interleukin receptors, including those of interleukin -2, -4, -7 and -21, and is thus referred to as the common gamma chain. Mutations in this gene cause X-linked severe combined immunodeficiency (XSCID), as well as X-linked combined immunodeficiency (XCID), a less severe immunodeficiency disorder. [provided by RefSeq, Mar 2010]'
• Locus ID: 3561