IL2 Receptor gamma (IL2RG) (NM_000206) Human 3' UTR Clone

CAT#: SC204808

3`UTR clone of interleukin 2 receptor gamma (severe combined immunodeficiency) (IL2RG) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "IL2RG"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol IL2RG
Synonyms CD132; CIDX; IL-2RG; IMD4; P64; SCIDX; SCIDX1
ACCN NM_000206
Insert Size 320 bp
Sequence Data
>SC204808 3'UTR clone of NM_000206
The sequence shown below is from the reference sequence of NM_000206. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CACCCTAAAGCCTGAAACCTGAACCCCAATCCTCTGACAGAAGAACCCCAGGGTCCTGTAGCCCTAAGTG
GTACTAACTTTCCTTCATTCAACCCACCTGCGTCTCATACTCACCTCACCCCACTGTGGCTGATTTGGAA
TTTTGTGCCCCCATGTAAGCACCCCTTCATTTGGCATTCCCCACTTGAGAATTACCCTTTTGCCCCGAAC
ATGTTTTTCTTCTCCCTCAGTCTGGCCCTTCCTTTTCGCAGGATTCTTCCTCCCTCCCTCTTTCCCTCCC
TTCCTCTTTCCATCTACCCTCCGATTGTTCCTGAACCGAT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_000206.2
Summary 'The protein encoded by this gene is an important signaling component of many interleukin receptors, including those of interleukin -2, -4, -7 and -21, and is thus referred to as the common gamma chain. Mutations in this gene cause X-linked severe combined immunodeficiency (XSCID), as well as X-linked combined immunodeficiency (XCID), a less severe immunodeficiency disorder. [provided by RefSeq, Mar 2010]'
Locus ID 3561

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.