Cyclophilin E (PPIE) (NM_006112) Human 3' UTR Clone

CAT#: SC204810

3`UTR clone of peptidylprolyl isomerase E (cyclophilin E) (PPIE) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PPIE
• Synonyms: CYP-33; CYP33
• ACCN: NM_006112
• Insert Size: 370
• Sequence Data:
  Insert Sequence

  >SC204810 3'UTR clone of NM_006112
  The sequence shown below is from the reference sequence of NM_006112. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGCCAAAGCAGAAGGTGATCATCGCCGACTGTGGGGAGTACGTGTGAGGCGGCACTCTCTCTGCTTCCCC
  CTCCGCTCTTGACCCTGCATATCCAGGAAGGAACTGCCAGCCTCAGAGGAGGCAGCACCGAGGGTGCCTG
  TTTGAAGCAAGCAGCATTTGGGATATGTGCCCTTCCTCAGGGTCTGCTTGGAGCAGCTCCTCTGCAGGCA
  CAGCCTGGACTATTCCCAGGCACAGCTGTGGGCCCAGGAGCCAGCTCAGGTGCTCCCCTCCACCATGGGC
  AGGCTGTGCAAAAAGCCACTGGCTTTTCTCAGCATTTGCTGCTGGGCCTCTCCTGGGACTACCAGTGTGG
  CTCTTACGTGTTTTCTTTGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_006112.2
• Summary: The protein encoded by this gene is a member of the peptidyl-prolyl cis-trans isomerase (PPIase) family. PPIases catalyze the cis-trans isomerization of proline imidic peptide bonds in oligopeptides and accelerate the folding of proteins. This protein contains a highly conserved cyclophilin (CYP) domain as well as an RNA-binding domain. It was shown to possess PPIase and protein folding activities, and it also exhibits RNA-binding activity. Alternative splicing results in multiple transcript variants. A related pseudogene, which is also located on chromosome 1, has been identified. [provided by RefSeq, Aug 2010]
• Locus ID: 10450