Prealbumin (TTR) (NM_000371) Human 3' UTR Clone

CAT#: SC204815

3`UTR clone of transthyretin (TTR) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TTR
• Synonyms: ATTR; CTS; CTS1; HEL111; HsT2651; PALB; TBPA
• ACCN: NM_000371
• Insert Size: 369 bp
• Sequence Data:
  Insert Sequence

  >SC204815 3'UTR clone of NM_000371
  The sequence shown below is from the reference sequence of NM_000371. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCTACTCCTATTCCACCACGGCTGTCGTCACCAATCCCAAGGAATGAGGGACTTCTCCTCCAGTGGACCT
  GAAGGACGAGGGATGGGATTTCATGTAACCAAGAGTATTCCATTTTTACTAAAGCAGTGTTTTCACCTCA
  TATGCTATGTTAGAAGTCCAGGCAGAGACAATAAAACATTCCTGTGAAAGGCACTTTTCATTCCACTTTA
  ACTTGATTTTTTAAATTCCCTTATTGTCCCTTCCAAAAAAAAGAGAATCAAAATTTTACAAAGAATCAAA
  GGAATTCTAGAAAGTATCTGGGCAGAACGCTAGGAGAGATCCAAATTTCCATTGTCTTGCAAGCAAAGCA
  CGTATTAAATATGATCTGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000371.3
• Summary: 'This gene encodes one of the three prealbumins, which include alpha-1-antitrypsin, transthyretin and orosomucoid. The encoded protein, transthyretin, is a homo-tetrameric carrier protein, which transports thyroid hormones in the plasma and cerebrospinal fluid. It is also involved in the transport of retinol (vitamin A) in the plasma by associating with retinol-binding protein. The protein may also be involved in other intracellular processes including proteolysis, nerve regeneration, autophagy and glucose homeostasis. Mutations in this gene are associated with amyloid deposition, predominantly affecting peripheral nerves or the heart, while a small percentage of the gene mutations are non-amyloidogenic. The mutations are implicated in the etiology of several diseases, including amyloidotic polyneuropathy, euthyroid hyperthyroxinaemia, amyloidotic vitreous opacities, cardiomyopathy, oculoleptomeningeal amyloidosis, meningocerebrovascular amyloidosis and carpal tunnel syndrome. [provided by RefSeq, Aug 2017]'
• Locus ID: 7276