HDAC6 (NM_006044) Human 3' UTR Clone

CAT#: SC204820

3`UTR clone of histone deacetylase 6 (HDAC6) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HDAC6
• Synonyms: CPBHM; HD6; JM21; PPP1R90
• ACCN: NM_006044
• Insert Size: 379
• Sequence Data:
  Insert Sequence

  >SC204820 3'UTR clone of NM_006044
  The sequence shown below is from the reference sequence of NM_006044. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCCACCAGAACAAGTTTGGGGAGGATATGCCCCACCCACACTAAGCCCCAGAATACGGTCCCTCTTCACC
  TTCTGAGGCCCACGATAGACCAGCTGTAGCTCATTCCAGCCTGTACCTTGGATGAGGGGTAGCCTCCCAC
  TGCATCCCATCCTGAATATCCTTTGCAACTCCCCAAGAGTGCTTATTTAAGTGTTAATACTTTTAAGAGA
  ACTGCGACGATTAATTGTGGATCTCCCCCTGCCCATTGCCTGCTTGAGGGGCACCACTACTCCAGCCCAG
  AAGGAAAGGGGGGCAGCTCAGTGGCCCCAAGAGGGAGCTGATATCATGAGGATAACATTGGCGGGAGGGG
  AGTTAACTGGCAGGCATGGCAAGGTTGCA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_006044.2
• Summary: Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to class II of the histone deacetylase/acuc/apha family. It contains an internal duplication of two catalytic domains which appear to function independently of each other. This protein possesses histone deacetylase activity and represses transcription. [provided by RefSeq, Jul 2008]
• Locus ID: 10013