PPAP2C (NM_177543) Human 3' UTR Clone

CAT#: SC204856

3`UTR clone of phosphatidic acid phosphatase type 2C (PPAP2C) transcript variant 3 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "PPAP2C"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol PPAP2C
Synonyms LPP2; PAP-2c; PAP2-g; PPAP2C
ACCN NM_177543
Insert Size 374
Sequence Data
>SC204856 3'UTR clone of NM_177543
The sequence shown below is from the reference sequence of NM_177543. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

ACCACTATGGATACCCGCACTCCTCCTCCTGAGGCCGGACCCCGCCCAGGCAGGGAGCTGCTGTGAGTCC
AGCTGAGGCCCACCCAGGTGGTCCCTCCAGCCCTGGTTAGGCACTGAGGGCTCTGGACGGGCTCCAGGAA
CCCTGGGCTGATGGGAGCAGTGAGCGGGCTCCGCTGCCCCCTGCCCTGCACTGGACCAGGAGTCTGGAGA
TGCCTGGGTAGCCCTCAGCATTTGGAGGGGAACCTGTTCCCGTCGGTCCCCAAATATCCCCTTCTTTTTA
TGGGGTTAAGGAAGGGACCGAGAGATCAGATAGTTGCTGTTTTGTAAAATGTAATGTATATGTGGTTTTT
AGTAAAATAGGGCACCTGTTTCAC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_177543.1
Summary The protein encoded by this gene is a member of the phosphatidic acid phosphatase (PAP) family. PAPs convert phosphatidic acid to diacylglycerol, and function in de novo synthesis of glycerolipids as well as in receptor-activated signal transduction mediated by phospholipase D. This protein is similar to phosphatidic acid phosphatase type 2A (PPAP2A) and type 2B (PPAP2B). All three proteins contain 6 transmembrane regions, and a consensus N-glycosylation site. This protein has been shown to possess membrane associated PAP activity. Three alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Locus ID 8612

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.