ACAA2 (NM_006111) Human 3' UTR Clone

CAT#: SC204861

3`UTR clone of acetyl-Coenzyme A acyltransferase 2 (ACAA2) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ACAA2
• Synonyms: DSAEC
• ACCN: NM_006111
• Insert Size: 373
• Sequence Data:
  Insert Sequence

  >SC204861 3'UTR clone of NM_006111
  The sequence shown below is from the reference sequence of NM_006111. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCCAAGGTATTGCTGTCATCATTCAGAGCACAGCCTGAAGAGACCAGTGAGCTCACTGTGACCCATCCTT
  ACTCTACTTGGCCAGGCCACAGTAAAACAAGTGACCTTCAGAGCAGCTGCCACAACTGGCCATGCCCTGC
  CATTGAAACAGTGATTAAGTTTGATCAAGCCATGGTGACACAAAAATGCATTGATCATGAATAGGAGCCC
  ATGCTAGAAGTACATTCTCTCAGATTTGAACCAGTGAAATATGATGTATTTCTGAGCTAAAACTCAACTA
  TAGAAGACATTAAAAGAAATCGTATTCTTGCCAAGTAACCACCACTTCTGCCTTAGATAATATGATTATA
  AGGAAATCAAATAAATGTTGCCT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_006111.2
• Summary: The encoded protein catalyzes the last step of the mitochondrial fatty acid beta-oxidation spiral. Unlike most mitochondrial matrix proteins, it contains a non-cleavable amino-terminal targeting signal. [provided by RefSeq, Jul 2008]
• Locus ID: 10449