alpha 1a Adrenergic Receptor (ADRA1A) (NM_033302) Human 3' UTR Clone

CAT#: SC204876

3`UTR clone of adrenergic alpha-1A- receptor (ADRA1A) transcript variant 3 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ADRA1A"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ADRA1A
Synonyms ADRA1C; ADRA1L1; ALPHA1AAR
ACCN NM_033302
Insert Size 403 bp
Sequence Data
>SC204876 3'UTR clone of NM_033302
The sequence shown below is from the reference sequence of NM_033302. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CAATCCTCCTGTACCACAGCCCGGGGACACACACCCATGACATGAAGCCAGCTTCCCGTCCACGACTGTT
GTCCTTACTGCCCAAGGAAGGGGAGCATGAAACCCACCACTGGTCCTGCGACCCACTGTCTTTGGAATCC
ACCCCAGGAGCCCAGGAGCCTTGCCTGACACTTGGATTTACTTCTTTATCAAGCATCCATCTGACTAAGG
CACAAATCCAACATGTTACTGTTACTGATACAGGAAAAACAGTAACTTAAGGAATGATCATGAATGCAAA
GGGAAAGAGGAAAAGAGCCTTCAGGGACAAATAGCTCGATTTTTTGTAAATCAGTTTCATACAACCTCCC
TCCCCCATTTCATTCTTAAAAGTTAATTGAGAATCATCAGCCACGTGTAGGGT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_033302.2
Summary 'Alpha-1-adrenergic receptors (alpha-1-ARs) are members of the G protein-coupled receptor superfamily. They activate mitogenic responses and regulate growth and proliferation of many cells. There are 3 alpha-1-AR subtypes: alpha-1A, -1B and -1D, all of which signal through the Gq/11 family of G-proteins and different subtypes show different patterns of activation. This gene encodes alpha-1A-adrenergic receptor. Alternative splicing of this gene generates four transcript variants, which encode four different isoforms with distinct C-termini but having similar ligand binding properties. [provided by RefSeq, Jul 2008]'
Locus ID 148

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.