MEK5 (MAP2K5) (NM_002757) Human 3' UTR Clone

CAT#: SC204902

3`UTR clone of mitogen-activated protein kinase kinase 5 (MAP2K5) transcript variant B for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "MAP2K5"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol MAP2K5
Synonyms HsT17454; MAPKK5; MEK5; PRKMK5
ACCN NM_002757
Insert Size 367 bp
Sequence Data
>SC204902 3'UTR clone of NM_002757
The sequence shown below is from the reference sequence of NM_002757. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GAGAGGCGGAGCCAGCAGGGGCCCCCGTGAGGCTGCCGCAGGGCACTGAAAGCCCAGGACCAGTAACCAA
GGAGAACAACCCACCCGTCGCCCTTCTCCGTATGCTGCCTGCGCCAGAAGAGCTTTGCTGGGCCCTGGCT
TCCCTGCCCTCGCCTTCACCTCTGTCAGCAGGTGGCCTTGCCTGGGGAGCCCCATGTGTGGCCCACCCCA
CCAGGCCATCCCCATACCTTCTGGTTTGAAGGCGCTGACACTGGCAGAGAGGTAAAGGGTGGGGCATTGA
GAATGGAGGCTCCCAGGGTCCCTGCCCACTTCTGTTTTCCTAATGTTTTTCTCTATAAAGGGTCAGGCCC
GTCAGCATCACTGATGG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_002757.2
Summary 'The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase specifically interacts with and activates MAPK7/ERK5. This kinase itself can be phosphorylated and activated by MAP3K3/MEKK3, as well as by atypical protein kinase C isoforms (aPKCs). The signal cascade mediated by this kinase is involved in growth factor stimulated cell proliferation and muscle cell differentiation. Three alternatively spliced transcript variants of this gene encoding distinct isoforms have been described. [provided by RefSeq, May 2011]'
Locus ID 5607

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.