MEK5 (MAP2K5) (NM_002757) Human 3' UTR Clone

CAT#: SC204902

3`UTR clone of mitogen-activated protein kinase kinase 5 (MAP2K5) transcript variant B for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MAP2K5
• Synonyms: HsT17454; MAPKK5; MEK5; PRKMK5
• ACCN: NM_002757
• Insert Size: 367 bp
• Sequence Data:
  Insert Sequence

  >SC204902 3'UTR clone of NM_002757
  The sequence shown below is from the reference sequence of NM_002757. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAGAGGCGGAGCCAGCAGGGGCCCCCGTGAGGCTGCCGCAGGGCACTGAAAGCCCAGGACCAGTAACCAA
  GGAGAACAACCCACCCGTCGCCCTTCTCCGTATGCTGCCTGCGCCAGAAGAGCTTTGCTGGGCCCTGGCT
  TCCCTGCCCTCGCCTTCACCTCTGTCAGCAGGTGGCCTTGCCTGGGGAGCCCCATGTGTGGCCCACCCCA
  CCAGGCCATCCCCATACCTTCTGGTTTGAAGGCGCTGACACTGGCAGAGAGGTAAAGGGTGGGGCATTGA
  GAATGGAGGCTCCCAGGGTCCCTGCCCACTTCTGTTTTCCTAATGTTTTTCTCTATAAAGGGTCAGGCCC
  GTCAGCATCACTGATGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002757.2
• Summary: 'The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase specifically interacts with and activates MAPK7/ERK5. This kinase itself can be phosphorylated and activated by MAP3K3/MEKK3, as well as by atypical protein kinase C isoforms (aPKCs). The signal cascade mediated by this kinase is involved in growth factor stimulated cell proliferation and muscle cell differentiation. Three alternatively spliced transcript variants of this gene encoding distinct isoforms have been described. [provided by RefSeq, May 2011]'
• Locus ID: 5607