TRPC4 (NM_001135955) Human 3' UTR Clone

CAT#: SC204909

3`UTR clone of transient receptor potential cation channel subfamily C member 4 (TRPC4) transcript variant beta for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TRPC4
• Synonyms: HTRP-4; HTRP4; TRP4
• ACCN: NM_001135955
• Insert Size: 301 bp
• Sequence Data:
  Insert Sequence

  >SC204909 3'UTR clone of NM_001135955
  The sequence shown below is from the reference sequence of NM_001135955. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGACACAGTCACCCACGAAGATTACGTGACCACAAGATTGTGATACTTGAAGGAGGAAGCGTTTACCATA
  CACATACGTATTTTCCGTAGTGCTCTGGGTGGGGGAAAATGTTTAAATTGTATTAGCAAATGCTAACTTA
  CACTTTATAGCGTTTATCAGCTGTGGCATATTACCTGTAACATGTTTAAATAAGGCAAAGGCAATCAAAA
  ACCTTTTTGTTTTGTAGCCTGCTTTTGCTTTCACAATTTGTCTTACAATTGTTTTTGTTAATAAATAAAT
  GCACCTTGTATTCTTGTACTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001135955.1
• Summary: 'This gene encodes a member of the canonical subfamily of transient receptor potential cation channels. The encoded protein forms a non-selective calcium-permeable cation channel that is activated by Gq-coupled receptors and tyrosine kinases, and plays a role in multiple processes including endothelial permeability, vasodilation, neurotransmitter release and cell proliferation. Single nucleotide polymorphisms in this gene may be associated with generalized epilepsy with photosensitivity. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]'
• Locus ID: 7223