EXOSC3 (NM_016042) Human 3' UTR Clone

CAT#: SC204958

3`UTR clone of exosome component 3 (EXOSC3) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "EXOSC3"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol EXOSC3
Synonyms bA3J10.7; CGI-102; hRrp-40; p10; PCH1B; RRP40; Rrp40p
ACCN NM_016042
Insert Size 376
Sequence Data
>SC204958 3'UTR clone of NM_016042
The sequence shown below is from the reference sequence of NM_016042. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GATCTTCTCCAGATTGGCAGAAAGTTGATATAGGTGGACTTTTTTACAGGTCAGTTGAGGCAAAAAACTA
TGGGTTTTTTCAGGTGAACCTCCCCCATTTAAATACTCAGAAGATAAGGTGTGAATGTATGTATTATTAG
AGTCCGAAAGTATTTTTATAAGTTACTGGTTTTCACCCACGCTTTTGTGGGAGAGAAAATCATTGCAAAA
TCATTTTTTTTGTTCGGTACAATAAAGTTTACTAAAAAACAGTATTAGGGTTTATTTGGAGTTAACTCCC
TTAGTAATTGCTACAGCTTCCATAATTAACTGGAGGTCAGCAGTAAAATAATTTTGTGATTATAACAGTA
AGCCAGGTTCACCAGAGGAAATGTGG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_016042.2
Summary This gene encodes a non-catalytic component of the human exosome, a complex with 3'-5' exoribonuclease activity that plays a role in numerous RNA processing and degradation activities. Related pseudogenes of this gene are found on chromosome 19 and 21. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jun 2012]
Locus ID 51010

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.