GPR172B (SLC52A1) (NM_017986) Human 3' UTR Clone

CAT#: SC204965

3`UTR clone of G protein-coupled receptor 172B (GPR172B) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SLC52A1
• Synonyms: GPCR42; GPR172B; hRFT1; PAR2; RBFVD; RFT1; RFVT1
• ACCN: NM_017986
• Insert Size: 370
• Sequence Data:
  Insert Sequence

  >SC204965 3'UTR clone of NM_017986
  The sequence shown below is from the reference sequence of NM_017986. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCAGAAAGGACTGTGTAGACCCCTGTGGCCCCTGAGCCTGGGCAGGTGGGGACCCAACTCCACCCCACCT
  GTCTTCATCGTGAGGCTGCCACAGTGCCTGACTACTTGTGGCCCAGGCAGGCTTCCCCCAACACAGGAAC
  GCTCATGGACACCTGCACACTCCACAGAAGACGTTGGCATGTGAGGCCAGGGTGGGCACCAAAGACCAGG
  CCCAGAGCCAGGGGACAGGTTGGGGCTGTGGGCTTGGACCCAGGGCCTGAGACCTTTGTGGGATTTGTGC
  AATAAAGTGTTTTTATTTAAAACCAAAAACAAAAACAAAAGCCTAATGAAAACCTTATAAGAAATATATA
  ATGAAATCAGGAAACTGGAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_017986.3
• Summary: Biological redox reactions require electron donors and acceptor. Vitamin B2 is the source for the flavin in flavin adenine dinucleotide (FAD) and flavin mononucleotide (FMN) which are common redox reagents. This gene encodes a member of the riboflavin (vitamin B2) transporter family. Haploinsufficiency of this protein can cause maternal riboflavin deficiency. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jan 2013]
• Locus ID: 55065