CARD9 (NM_052813) Human 3' UTR Clone

CAT#: SC204980

3`UTR clone of caspase recruitment domain family member 9 (CARD9) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CARD9
• Synonyms: CANDF2; hCARD9
• ACCN: NM_052813
• Insert Size: 362
• Sequence Data:
  Insert Sequence

  >SC204980 3'UTR clone of NM_052813
  The sequence shown below is from the reference sequence of NM_052813. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GACAACACCGACACTGAGGGCTCCTAGCCGCAGCAGCGCAGGCCCCGACCAGGGCACACCCACCGGCCCG
  GCCTCCTGCCACCCGGGGGTGCCGACGCCCTGGGGCGCAGACTTCCCCGAGCCGTCGCTGACTTGGCCTG
  GAACGAGGAATCTGGTGCCCTGAAAGGCCCAGCCGGACTGCCGGGCATTGGGGCCGTTTGTTAAGCGGCA
  CTCATTTTGCGGAGGCCATGCGGGTGCTCACCACCCCCATGCACACGCCATCTGTGTAACTTCAGGATCT
  GTTCTGTTTCACCATGTAACACACAATACATGCATGCATTGTATTAGTGTTAGAAAACACAGCTGCGTAA
  ATAAACAGCACG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_052813.4
• Summary: The protein encoded by this gene is a member of the CARD protein family, which is defined by the presence of a characteristic caspase-associated recruitment domain (CARD). CARD is a protein interaction domain known to participate in activation or suppression of CARD containing members of the caspase family, and thus plays an important regulatory role in cell apoptosis. This protein was identified by its selective association with the CARD domain of BCL10, a postive regulator of apoptosis and NF-kappaB activation, and is thought to function as a molecular scaffold for the assembly of a BCL10 signaling complex that activates NF-kappaB. Several alternatively spliced transcript variants have been observed, but their full-length nature is not clearly defined. [provided by RefSeq, Jul 2008]
• Locus ID: 64170