PPP1A (PPP1CA) (NM_002708) Human 3' UTR Clone

CAT#: SC205017

3`UTR clone of protein phosphatase 1 catalytic subunit alpha isoform (PPP1CA) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PPP1CA
• Synonyms: PP-1A; PP1A; PP1alpha; PPP1A
• ACCN: NM_002708
• Insert Size: 380 bp
• Sequence Data:
  Insert Sequence

  >SC205017 3'UTR clone of NM_002708
  The sequence shown below is from the reference sequence of NM_002708. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CGCAATTCCGCCAAAGCCAAGAAATAGCCCCCGCACACCACCCTGTGCCCCAGATGATGGATTGATTGTA
  CAGAAATCATGCTGCCATGCTGGGGGGGGGTCACCCCGACCCCTCAGGCCCACCTGTCACGGGGAACATG
  GAGCCTTGGTGTATTTTTCTTTTCTTTTTTTAATGAATCAATAGCAGCGTCCAGTCCCCCAGGGCTGCTT
  CCTGCCTGCACCTGCGGTGACTGTGAGCAGGATCCTGGGGCCGAGGCTGCAGCTCAGGGCAACGGCAGGC
  CAGGTCGTGGGTCTCCAGCCGTGCTTGGCCTCAGGGCTGGCAGCCGGATCCTGGGGCAACCCATCTGGTC
  TCTTGAATAAAGGTCAAAGCTGGATTCTCG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002708.3
• Summary: 'The protein encoded by this gene is one of the three catalytic subunits of protein phosphatase 1 (PP1). This broadly expressed gene encodes the alpha subunit of the PP1 complex that associates with over 200 regulatory proteins to form holoenzymes which dephosphorylate their biological targets with high specificity. PP1 is a serine/threonine specific protein phosphatase known to be involved in the regulation of a variety of cellular processes, such as cell division, glycogen metabolism, muscle contractility, protein synthesis, and HIV-1 viral transcription. Increased PP1 activity has been observed in the end stage of heart failure. Studies suggest that PP1 is an important regulator of cardiac function and that PP1 deregulation is implicated in diabetes and multiple types of cancer. Three alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2020]'
• Locus ID: 5499