IDH3B (NM_174856) Human 3' UTR Clone

CAT#: SC205019

3`UTR clone of isocitrate dehydrogenase 3 (NAD+) beta (IDH3B) nuclear gene encoding mitochondrial protein transcript variant 3 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: IDH3B
• Synonyms: FLJ11043; H-IDHB; MGC903; RP46
• ACCN: NM_174856
• Insert Size: 372 bp
• Sequence Data:
  Insert Sequence

  >SC205019 3'UTR clone of NM_174856
  The sequence shown below is from the reference sequence of NM_174856. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAAGTCTGTCATCGGTCACCTGCAGACTAAAGGGAGCTAGAGCCCTTTATTTCTTCCAACCTTGCAAGGA
  CCACACTCCCCATACCCTTCAGTGCAGTGTACCAGGGAAGAGACCTTGTGCCTCTAAGCAGTGGACCATG
  GTCACCTTGCTGGGTAGAGCCTAGGTTGTCCTTGGGCCGGCTTCCTTAGGGGACAGACTGTTGGGTGGTG
  ATGGGGATTGTTAGGATGGAGCCCAGGCCACATGGATGATGATGATTCTCCCCCACAGGTTCGAACCTCT
  GACATGGGTGGCTATGCTACTTGCCATGACTTCACTGAGGCTGTCATTGCTGCCTTGCCCCACCCATAGG
  CCCTGTCCATACCCATGTAAGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_174856.1
• Summary: 'Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. NAD(+)-dependent isocitrate dehydrogenases catalyze the allosterically regulated rate-limiting step of the tricarboxylic acid cycle. Each isozyme is a heterotetramer that is composed of two alpha subunits, one beta subunit, and one gamma subunit. The protein encoded by this gene is the beta subunit of one isozyme of NAD(+)-dependent isocitrate dehydrogenase. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Sep 2016]'
• Locus ID: 3420