HLA-DQB1 (NM_002123) Human 3' UTR Clone

CAT#: SC205037

3`UTR clone of major histocompatibility complex class II DQ beta 1 (HLA-DQB1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HLA-DQB1
• Synonyms: CELIAC1; HLA-DQB; IDDM1
• ACCN: NM_002123
• Insert Size: 391 bp
• Sequence Data:
  Insert Sequence

  >SC205037 3'UTR clone of NM_002123
  The sequence shown below is from the reference sequence of NM_002123. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CATCCGTCAAAGGAGTCAGAAAGGGCTTCTGCACTGACTCCTGAGACTATTTTAACTAGGATTGGTTATC
  ACTCTTCTGTGATGCCTGCTTATGCCTGCCCAGAATTCCCAGCTGCCTGTGTCAGCTTGTCCCCCTGAGA
  TCAAAGTCCTACAGTGGCTGTCACGCAGCCACCAGGTCATCTCCTTTCATCCCCACCCCAAGGCGCTGGC
  TGTGACTCTGCTTCCTGCACTGACCCAGAGCCTCTGCCTGTGCATGGCCAGCTGCGTCTACTCAGGTCCC
  AAGGGGTTTCTGTTTCTATTCTTTCCTCAGACTGCTCAAGAGAAGCACATGAAAAACATTACCTGACTTT
  AGAGCTTTTTTACATAATTAAACATGATCCTGAGTTATCTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002123.3
• Summary: 'HLA-DQB1 belongs to the HLA class II beta chain paralogs. This class II molecule is a heterodimer consisting of an alpha (DQA) and a beta chain (DQB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa and it contains six exons. Exon 1 encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. Within the DQ molecule both the alpha chain and the beta chain contain the polymorphisms specifying the peptide binding specificities, resulting in up to four different molecules. Typing for these polymorphisms is routinely done for bone marrow transplantation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]'
• Locus ID: 3119