Plakophilin 3 (PKP3) (NM_007183) Human 3' UTR Clone

CAT#: SC205046

3`UTR clone of plakophilin 3 (PKP3) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PKP3
• Synonyms: plakophilin 3
• ACCN: NM_007183
• Insert Size: 342
• Sequence Data:
  Insert Sequence

  >SC205046 3'UTR clone of NM_007183
  The sequence shown below is from the reference sequence of NM_007183. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCTATCGGAAGGAGGACTTCCTGGGCCCATAGGTGAAGCCTTCTGGAGGAGAAGGTGACGTGGCCCAGCG
  TCCAAGGGACAGACTCAGCTCCAGGCTGCTTGGCAGCCCAGCCTGGAGGAGAAGGCTAATGACGGAGGGG
  CCCCTCGCTGGGGCCCCTGTGTGCATCTTTGAGGGTCCTGGGCCACCAGGAGGGGCAGGGTCTTATAGCT
  GGGGACTTGGCTTCCGCAGGGCAGGGGGTGGGGCAGGGCTCAAGGCTGCTCTGGTGTATGGGGTGGTGAC
  CCAGTCACATTGGCAGAGGTGGGGGTTGGCTGTGGCCTGGCAGTATCTTGGGATAGCCAGCA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_007183.2
• Summary: This gene encodes a member of the arm-repeat (armadillo) and plakophilin gene families. Plakophilin proteins contain numerous armadillo repeats, localize to cell desmosomes and nuclei, and participate in linking cadherins to intermediate filaments in the cytoskeleton. This protein may act in cellular desmosome-dependent adhesion and signaling pathways. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2014]
• Locus ID: 11187