MRP4 (ABCC4) (NM_001105515) Human 3' UTR Clone

CAT#: SC205083

3`UTR clone of ATP-binding cassette sub-family C (CFTR/MRP) member 4 (ABCC4) transcript variant 2 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ABCC4"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ABCC4
Synonyms MOAT-B; MOATB; MRP4
ACCN NM_001105515
Insert Size 396
Sequence Data
>SC205083 3'UTR clone of NM_001105515
The sequence shown below is from the reference sequence of NM_001105515. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

ATCTCGCTGTGTTGTCCTGGCTGGTCTCAAACTCCTAGGCTCAAGCAATCCTCCTCCCTCCTCAAGCAAA
CCTCAGTGCTGGGATTATAGGCATGAGCCACTGTACCTGGCTAAATGTTGTTTTTTTGATATTCAATTTT
TGTTTATAGAATTTTCATTTGTTTTGCTCTTATACTTTTCATCTTTTTATGTTTATTGACCAATTAAATA
TCATTTGGGTAAGCACCTATTTAAGTGTCTTAACAATTTTTCTATTGAGTACTCTGGGTTTTTGTTTTGT
TTTTCTTACTGATTTGTAGAATTCTTTATGTATTCTGAATTGCAGATACCTTCCTTCTGTACTAATGCTT
ATCTTTTTAGCCCTGTAATATTGTGTTTTCATAAACATACTTATCA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001105515.1
Summary The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This family member plays a role in cellular detoxification as a pump for its substrate, organic anions. It may also function in prostaglandin-mediated cAMP signaling in ciliogenesis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2014]
Locus ID 10257

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.