ZAP70 (NM_207519) Human 3' UTR Clone

CAT#: SC205145

3`UTR clone of zeta-chain (TCR) associated protein kinase 70kDa (ZAP70) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ZAP70
• Synonyms: ADMIO2; IMD48; SRK; STCD; STD; TZK; ZAP-70
• ACCN: NM_207519
• Insert Size: 374 bp
• Sequence Data:
  Insert Sequence

  >SC205145 3'UTR clone of NM_207519
  The sequence shown below is from the reference sequence of NM_207519. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGCACACAGAAGGCTGAGGCTGCCTGTGCCTGAGCTCCCGCTGCCCAGGGGAGCCCTCCACGCCGGCTCT
  TCCCCACCCTCAGCCCCACCCCAGGTCCTGCAGTCTGGCTGAGCCCTGCTTGGTTGTCTCCACACACAGC
  TGGGCTGTGGTAGGGGGTGTCTCAGGCCACACCGGCCTTGCATTGCCTGCCTGGCCCCCTGTCCTCTCTG
  GCTGGGGAGCAGGGAGGTCCGGGAGGGTGCGGCTGTGCAGCCTGTCCTGGGCTGGTGGCTCCCGGAGGGC
  CCTGAGCTGAGGGCATTGCTTACACGGATGCCTTCCCCTGGGCCCTGACATTGGAGCCTGGGCATCCTCA
  GGTGGTCAGGCGTAGATCACCAGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_207519.1
• Summary: 'This gene encodes an enzyme belonging to the protein tyrosine kinase family, and it plays a role in T-cell development and lymphocyte activation. This enzyme, which is phosphorylated on tyrosine residues upon T-cell antigen receptor (TCR) stimulation, functions in the initial step of TCR-mediated signal transduction in combination with the Src family kinases, Lck and Fyn. This enzyme is also essential for thymocyte development. Mutations in this gene cause selective T-cell defect, a severe combined immunodeficiency disease characterized by a selective absence of CD8-positive T-cells. Two transcript variants that encode different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]'
• Locus ID: 7535