TARS (NM_152295) Human 3' UTR Clone

CAT#: SC205156

3`UTR clone of threonyl-tRNA synthetase (TARS) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TARS
• Synonyms: ThrRS
• ACCN: NM_152295
• Insert Size: 394 bp
• Sequence Data:
  Insert Sequence

  >SC205156 3'UTR clone of NM_152295
  The sequence shown below is from the reference sequence of NM_152295. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AAGAGTTCCGCAGCAAACAGGCAGAAGAAGAATTTTAATGAAAAAATTACCCAGATTGGCTCCATGGAAA
  AGGAGGAACAGCGTTTCCGTAAAATTGACTTTGTACTCTGAAAACGTCAATTTATATTGAACTTGGAGGA
  GTTTGGCAAAGTCTGAATAGGTCAACCTGCAGGCGTAACTATTTTTGACCTAGTCAGTTTTTAAACAATG
  TGCATTTGAAGGAGTTAATTAAAAGAGAGCCAATAAAATGATTTTACTCATTCAGTATCTGAGTACTGGA
  AGTGAAACATGAGGAATGCTTTAGTGTAATGTGGGAGAACTTTTTTGTAAATTTAATGCAATTGAAAAAG
  TTTTCAAATTCAATTAAGATAACTAGAATTGGATTATGGTGTAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_152295.3
• Summary: 'Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Threonyl-tRNA synthetase belongs to the class-II aminoacyl-tRNA synthetase family [provided by RefSeq, Jul 2008]'
• Locus ID: 6897