HLAG (HLA) (NM_002127) Human 3' UTR Clone

CAT#: SC205157

3`UTR clone of major histocompatibility complex class I G (HLA-G) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HLA
• Synonyms: MHC-G
• ACCN: NM_002127
• Insert Size: 383
• Sequence Data:
  Insert Sequence

  >SC205157 3'UTR clone of NM_002127
  The sequence shown below is from the reference sequence of NM_002127. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTGTGGAGAAAGAAGAGCTCAGATTGAAAAGGAGGGAGCTACTCTCAGGCTGCAATGTGAAACAGCTGCC
  CTGTGTGGGACTGAGTGGCAAGTCCCTTTGTGACTTCAAGAACCCTGACTCCTCTTTGTGCAGAGACCAG
  CCCACCCCTGTGCCCACCATGACCCTCTTCCTCATGCTGAACTGCATTCCTTCCCCAATCACCTTTCCTG
  TTCCAGAAAAGGGGCTGGGATGTCTCCGTCTCTGTCTCAAATTTGTGGTCCACTGAGCTATAACTTACTT
  CTGTATTAAAATTAGAATCTGAGTATAAATTTACTTTTTCAAATTATTTCCAAGAGAGATTGATGGGTTA
  ATTAAAGGAGAAGATTCCTGAAATTTGAGAGAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_002127.5
• Summary: HLA-G belongs to the HLA class I heavy chain paralogues. This class I molecule is a heterodimer consisting of a heavy chain and a light chain (beta-2 microglobulin). The heavy chain is anchored in the membrane. HLA-G is expressed on fetal derived placental cells. The heavy chain is approximately 45 kDa and its gene contains 8 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the alpha1 and alpha2 domain, which both bind the peptide, exon 4 encodes the alpha3 domain, exon 5 encodes the transmembrane region, and exon 6 encodes the cytoplasmic tail. [provided by RefSeq, Jul 2008]
• Locus ID: 3135